TGAGCGATAGAGCTAGAGCTGAGCTAGGGATTCGAGGCTAGATCGATACGACTAGCTCGATAATGATCTGC
Book

TGAC* What future lies hidden in your DNA?

Thank you for deciding to join the growing group of people who are interested in TGAC. May I point out that you can give the book away too. And that when you do, you can add a giftcard with your own 200-character text. This text will be handwritten on your card and included in the package. The choice for a giftcard can be indicated on the next screen; the text you can key in in the screen after that. Whichever option you choose, thanks again for making someone enjoy the book.

Price per item: € 15,70

 

Number of items: 
Add to shopping cart