TGAGCGATAGAGCTAGAGCTGAGCTAGGGATTCGAGGCTAGATCGATACGACTAGCTCGATAATGATCTGC
Book

What has been said about 'TGAC': credit crunch, newspeak and ...

Is a new human species really fiction?

‘TGAC what future lies hidden in your DNA?’ claims its not

The debut novel by writer Sue Man seems to suggest we, Homo Sapiens will create our own successor. It even suggests it knows its blueprint. The book that is set-up and reads like a history book and  has a number of characters discussing this history. We learn, in well structured chapters how the human condition has evolved up until the moment where a quantum leap creates a break with the past. This break occurs when mankind, the current dominant Homo, i.e. us, creates our successor, the so called Homo Creans.

The human condition history then proceeds to sketch their lives, quandrums and pitfalls.

Other than the condition humain the book also investigates through a series of dialogues the values of us and of our successors. It discusses the relation to, as it puts it, ‘good’ and ‘gods’. Finally it discusses the history of coding and decoding in latest version of which is the decoding of the human genome, consisting as it does of the letters TGAC. Oh, and it has some interesting observations on reproduction under the heading ‘mate-needs-mate’.

The interrelations between the different narratives are well spelled out and make sense. Sue Man convinces in showing how these threads influence each other. She argues well how we relate to our offspring as our gods must have related to us, their offspring. Thus throwing perspectives on evolution as well as creationism wide open.

The difficult subject is treated with insight, while preaching, even though the subject seems to invite Man to do so, is nowhere to be found in the book.

A curious element is the inclusion of a code, as one chapter of the book. The accompanying website indicates that breaking the code will lead to a next ‘code’ which adds yet another layer to the book.

In all honesty the book does not need it as it is a unpretentious small masterpiece in its own right.

But now that the code has been included the reader is curious what it will reveal and how it may indeed turn out to lead to ‘two novels in one’.

Check, sorry, tgac out that website, tgac.com for answers.

Sue Man’s love of language

Mrs Man adds to the list of  ‘Scrooges’, ‘newspeak’ and ‘catch22’.

‘Whea’, ‘ghee’, Homo Creans, ‘mythematics’, are some of the new words which will linger in our vocabulary for years to come. ‘TGAC’, the opening word of the title, and pronounced as ‘check’, or ‘Czech’ is another. Books that add to our vocabulary are rare, but always great; so is Sue Man’s.

The style is innovative in that it only uses dialogue, without being a play. The language as said is innovative. The real punch is in the ideas which the book has in abundance. The creation of a new human species is not new as such but the convincing way the new Man is portrayed is compelling. Homo Creans, the book claims, will have an ability to change itself. Examples from nature such as sex-changing sea-horses make the mechanism even somewhat convincing. The real punch in the book may be in the discussion of the way we, homo sapiens relate to our ‘brain-child’, the homo creans. And the analogy with how we then relate to ‘our Gods’. This is where Sue Man’s influence on language may turn out to be greatest. The meaning of the word ‘God’, the meaning of the word ‘man’, our thinking about how we came into this world all this can change.

Part of this novel consists of a coded message. This message, it is suggested, is to be found in the human genome. This message remains unexplained and we are invited, by one of the characters to help de-code it. Sue Man’s ‘TGAC, what future lies hidden in your DNA?’ will, if only for that reason be talked about for some time to come. And Rightly so!

Thoughts to help us through the credit crunch

What characteristic is it in humans that make us produce inspiring works in times of crises?

Falling house-prices, mass layoffs, even Toyota not able to turn a profit; times are really, really bad. Obama may be our ‘Yes we can’-man, Sue Man is our ‘Yes we will’-guru. The rock solid conviction propounded in her debut novel ‘TGAC, what future lies in your DNA?’ in Homo Sapiens’ ability to really take charge is reassuring. We, homo sapiens, will create our successor and this successor will be better. In spite of our inabilities to get many things right (the economy, our marriages, our childrens future, the planet) we are at least ‘godlike’ in one way. We can create ‘a man’. And not just a Homo Sapiens v2.0, but a truly different homo-nimal. A human that can change itself, as an individual to suit it’s needs.

Let’s for a moment think this through. This homo will be able to live on less or turn cold blooded (energy bills out of the window). It can live happily without a mate as it can procreate by itself (no more wrecked marriages). Since it can kind of pre-programme its children, if I understand correctly, the issues, fights and disillusions we have with or about our offspring will be a thing of the past. And Richard Branson will be able to hand over his cash-prize for the one who will solve the CO2 emission problem as Homo Creans can make itself run on CO2 for a while until it switches back to ‘old fashioned' oxygen. 

Too good to be true, surely. The manner in which it presents its case however makes one wonder if not possibly, maybe, somewhere on this planet developments are going on which will make this true one day.

When, if, all this will be true one day, will be indeed start thinking about our Creator the way Sue Man talks about ‘Him’/them/it? The best part of the book may be in the carefully argued way through this minefield. Her detectors seem to work well as she manages to openly discuss difficult issues without getting argumentative. If, she says, we can create a human species that is superior to us, our greatness is in being less able, capable or powerful than our successors. And then why is this not true for our relationship with our alleged creator? Her thoughts on the nature of design ring true too and solve the question she rightly poses to a considerable extend. Whether she convinces you wholly seems to become irrelevant as the point by than has been made already: ‘Yes we will’.